ZN564.H14CORE.0.P.C motif - HOmo sapiens COmprehensive MOdel COllection

Motif	ZN564.H14CORE.0.P.C
Gene (human)	ZNF564 (GeneCards)
Gene synonyms (human)
Gene (mouse)
Gene synonyms (mouse)
LOGO
LOGO (reverse complement)
Motif subtype	0
Quality	C

Motif length	23
Consensus	TTGGACTTCCCAGCCTCCAGAAC
GC content	54.81%
Information content (bits; total / per base)	36.384 / 1.582
Data sources	ChIP-Seq
Aligned words	859
Previous names	ZN564.H12CORE.0.P.C

ChIP-Seq benchmarking	Num. of experiments (peaksets)	auROC, median	auROC, best	auPRC, median	auPRC, best	pseudo-auROC, median	pseudo-auROC, best	pseudo-log-auROC, median	pseudo-log-auROC, best	Centrality, median	Centrality, best
Human	1 (4)	0.969	0.982	0.969	0.981	0.97	0.987	19.042	19.575	299.407	406.252

TF superclass	Zinc-coordinating DNA-binding domains {2} (TFClass)
TF class	C2H2 zinc finger factors {2.3} (TFClass)
TF family	More than 3 adjacent zinc fingers {2.3.3} (TFClass)
TF subfamily	ZNF763-like {2.3.3.33} (TFClass)
TFClass ID	TFClass: 2.3.3.33.16
HGNC	HGNC:31106
MGI
EntrezGene (human)	GeneID:163050 (SSTAR profile)
EntrezGene (mouse)
UniProt ID (human)	ZN564_HUMAN
UniProt ID (mouse)
UniProt AC (human)	Q8TBZ8 (TFClass)
UniProt AC (mouse)
GRECO-DB-TF	yes

ChIP-Seq	1 human, 0 mouse
HT-SELEX	0
Methyl-HT-SELEX	0
Genomic HT-SELEX	0 overall: 0 Lysate, 0 IVT, 0 GFPIVT
SMiLE-Seq	0
PBM	0

PCM	ZN564.H14CORE.0.P.C.pcm
PWM	ZN564.H14CORE.0.P.C.pwm
PFM	ZN564.H14CORE.0.P.C.pfm
Threshold to P-value map	ZN564.H14CORE.0.P.C.thr
Motif in other formats
JASPAR format	ZN564.H14CORE.0.P.C_jaspar_format.txt
MEME format	ZN564.H14CORE.0.P.C_meme_format.meme
Transfac format	ZN564.H14CORE.0.P.C_transfac_format.txt
Homer format	ZN564.H14CORE.0.P.C_homer_format_0.001.txt ZN564.H14CORE.0.P.C_homer_format_0.0005.txt ZN564.H14CORE.0.P.C_homer_format_0.0001.txt

PCM

	A	C	G	T
01	4.0	11.0	2.0	842.0
02	19.0	9.0	22.0	809.0
03	11.0	2.0	841.0	5.0
04	61.0	10.0	784.0	4.0
05	840.0	8.0	9.0	2.0
06	3.0	840.0	5.0	11.0
07	4.0	7.0	1.0	847.0
08	6.0	9.0	21.0	823.0
09	11.0	734.0	47.0	67.0
10	39.0	783.0	19.0	18.0
11	2.0	853.0	1.0	3.0
12	828.0	11.0	11.0	9.0
13	30.0	12.0	797.0	20.0
14	7.0	788.0	7.0	57.0
15	1.0	850.0	1.0	7.0
16	32.0	114.0	5.0	708.0
17	2.0	790.0	36.0	31.0
18	12.0	678.0	18.0	151.0
19	820.0	2.0	29.0	8.0
20	15.0	27.0	799.0	18.0
21	826.0	6.0	19.0	8.0
22	756.0	23.0	74.0	6.0
23	12.0	702.0	11.0	134.0

PFM

	A	C	G	T
01	0.005	0.013	0.002	0.98
02	0.022	0.01	0.026	0.942
03	0.013	0.002	0.979	0.006
04	0.071	0.012	0.913	0.005
05	0.978	0.009	0.01	0.002
06	0.003	0.978	0.006	0.013
07	0.005	0.008	0.001	0.986
08	0.007	0.01	0.024	0.958
09	0.013	0.854	0.055	0.078
10	0.045	0.912	0.022	0.021
11	0.002	0.993	0.001	0.003
12	0.964	0.013	0.013	0.01
13	0.035	0.014	0.928	0.023
14	0.008	0.917	0.008	0.066
15	0.001	0.99	0.001	0.008
16	0.037	0.133	0.006	0.824
17	0.002	0.92	0.042	0.036
18	0.014	0.789	0.021	0.176
19	0.955	0.002	0.034	0.009
20	0.017	0.031	0.93	0.021
21	0.962	0.007	0.022	0.009
22	0.88	0.027	0.086	0.007
23	0.014	0.817	0.013	0.156

PWM

	A	C	G	T
01	-3.639	-2.837	-4.072	1.36
02	-2.348	-3.008	-2.212	1.321
03	-2.837	-4.072	1.359	-3.477
04	-1.239	-2.919	1.289	-3.639
05	1.358	-3.106	-3.008	-4.072
06	-3.832	1.358	-3.477	-2.837
07	-3.639	-3.215	-4.388	1.366
08	-3.338	-3.008	-2.255	1.338
09	-2.837	1.223	-1.492	-1.148
10	-1.671	1.288	-2.348	-2.397
11	-4.072	1.373	-4.388	-3.832
12	1.344	-2.837	-2.837	-3.008
13	-1.921	-2.761	1.306	-2.301
14	-3.215	1.294	-3.215	-1.305
15	-4.388	1.37	-4.388	-3.215
16	-1.86	-0.626	-3.477	1.188
17	-4.072	1.297	-1.748	-1.89
18	-2.761	1.144	-2.397	-0.349
19	1.334	-4.072	-1.953	-3.106
20	-2.563	-2.021	1.308	-2.397
21	1.341	-3.338	-2.348	-3.106
22	1.253	-2.171	-1.051	-3.338
23	-2.761	1.179	-2.837	-0.467

Standard thresholds

P-value	Threshold
0.001	-10.76884
0.0005	-8.78319
0.0001	-4.50434